Monday, January 2, 2012

Phred :: Install


Phred

The installation is in the server
working directory: /bioinfo/packages/Phred

Copy the phred-dist-020425.c-acd.tar.Z to above directory
$ uncompress phred-dist-020425.c-acd.tar.Z
$ tar xvf phred-dist-020425.c-acd.tar

Edit makefile to uncomment lines for 'UNIX specific definitions'
$ make

To set the environment variable
$ export PHRED_PARAMETER_FILE=\usr\local\etc\PhredPar\phredpar.dat

== Now ready to run phred

phd2fasta package
move the package to the working directory
$ uncompress phd2fasta-acd-dist.tar.Z
$ tar xvf phd2fasta-acd-dist.tar
$ make

The program can be executed as ./phd2fasta

Wednesday, December 7, 2011

Ruby :: Gem :: Jeweler

Write a gem in Ruby using Jeweler

Steps.
- Install gem called jeweler
$ gem install jeweler
Fetching: jeweler-1.6.4.gem (100%)
Successfully installed jeweler-1.6.4
1 gem installed
Installing ri documentation for jeweler-1.6.4...
Installing RDoc documentation for jeweler-1.6.4...

To execute the command, first checkout the options
$ jeweler --help

Now generate a new project using the command jeweler.
$ jeweler hello_gem
No github.user found in ~/.gitconfig. Please tell git about your GitHub account (see http://github.com/blog/180-local-github-config for details). For example: git config --global github.user defunkt

ERROR: The above command came up with an error. 

To fix the user
$ git config --global github.user defunkt
$ git config --global github.token 6ef8395fecf207165f1a82178ae1b984
- replace defunkt and 6ef8395fecf207165f1a82178ae1b984
with your user and token respectively.
- To get the token from the Github
On Github > Account Seetings > Account Admin > API token: Your token is ***********

Rerun the jeweler command to create a new project
- By default the test script are generated for shoulda
- I am familiar with Rspec so I chose Rspec for my testing.
$ jeweler hello_gem --rspec
create .gitignore
create Rakefile
create Gemfile
create LICENSE.txt
create README.rdoc
create .document
create lib
create lib/hello_gem.rb
create spec
create spec/spec_helper.rb
create spec/hello_gem_spec.rb
create .rspec
Jeweler has prepared your gem in ./hello_gem

The structure of the directories are
$ tree
.
└── hello_gem
    ├── Gemfile
    ├── lib
    │   └── hello_gem.rb
    ├── LICENSE.txt
    ├── Rakefile
    ├── README.rdoc
    └── spec
        ├── hello_gem_spec.rb
        └── spec_helper.rb

3 directories, 7 files

hello_gem doesnt have the rspec gem yet, so in the Gemfile
group :test do
gem 'rspec', "~> 2.3.0" 
end

Run the bundle install command to install the rspec gem
$ bundle install

To know all the rake commands that can run, 
$ rake -T
rake build               # Build gem into pkg/
rake clobber_rdoc        # Remove rdoc products
rake console[script]     # Start IRB with all runtime dependencies loaded
rake gemcutter:release   # Release gem to Gemcutter
rake gemspec             # Generate and validate gemspec
rake gemspec:debug       # Display the gemspec for debugging purposes, as jeweler knows it (not from the filesystem)
rake gemspec:generate    # Regenerate the gemspec on the filesystem
rake gemspec:release     # Regenerate and validate gemspec, and then commits and pushes to git
rake gemspec:validate    # Validates the gemspec on the filesystem
rake git:release         # Tag and push release to git.
rake install             # Build and install gem using `gem install`
rake rcov                # Run RSpec code examples
rake rdoc                # Build the rdoc HTML Files
rake release             # Release gem
rake rerdoc              # Force a rebuild of the RDOC files
rake spec                # Run RSpec code examples
rake version             # Displays the current version
rake version:bump:major  # Bump the major version by 1
rake version:bump:minor  # Bump the a minor version by 1
rake version:bump:patch  # Bump the patch version by 1
rake version:write       # Writes out an explicit version.

Before we start with the gem we need a version to it.
$ rake version:write MAJOR=0 MINOR=1 PATCH=0
Updated version: 0.1.0

To know the current version
$ rake version
Current version: 0.1.0

Now install the gem 
$ rake install
rake aborted!
"FIXME" or "TODO" is not a description

Tasks: TOP => install => build
(See full trace by running task with --trace)

NOTE: If you get this error, then open the Rakefile
Change the lines from 
  gem.summary = %Q{TODO: one-line summary of your gem}
  gem.description = %Q{longer description of your gem}
to
  gem.summary = "one-line summary of your gem"
  gem.description = "longer description of your gem"

Now try again
$ rake install
  Successfully built RubyGem
  Name: hello_gem
  Version: 0.1.0
  File: hello_gem-0.1.0.gem
Executing "ruby -S gem install ./pkg/hello_gem-0.1.0.gem":
ruby -S gem install ./pkg/hello_gem-0.1.0.gem
Successfully installed hello_gem-0.1.0
1 gem installed
Installing ri documentation for hello_gem-0.1.0...
Installing RDoc documentation for hello_gem-0.1.0...

Now you can push the gem to Github and Rubygems.org
First commit all the changes to Git
$ git add .
$ git commit -am "inital setup"

Second create an repository at github, and call it hello_gem
This will create a repository called hello_gem.git

Run the command
$ rake release
Committing hello_gem.gemspec
Pushing master to origin
Generated: hello_gem.gemspec
hello_gem.gemspec is valid.
  Successfully built RubyGem
  Name: hello_gem
  Version: 0.1.0
  File: hello_gem-0.1.0.gem
Executing "gem push ./pkg/hello_gem-0.1.0.gem":
gem push ./pkg/hello_gem-0.1.0.gem
Pushing gem to https://rubygems.org...
You do not have permission to push to this gem.
rake aborted!
Command failed with status (1): [gem push ./pkg/hello_gem-0.1.0.gem...]

- It generated the gemspec file
- validates the hello_gem.spec
- It pushes the gem to GIT
- ERROR: It fails to push the gem to rubygems.org

Gems are no longer hosted by Github, It has moved to Rubygems.org
- To move gems to Rubygems, use Gemcutter
- To install gemcutter
$ gem update --system

Now install the gem
$ gem install gemcutter

Now stay in the hello_gem folder, and build the gem
$ gem build hello_gem.gemspec 
  Successfully built RubyGem
  Name: hello_gem
  Version: 0.1.0
  File: hello_gem-0.1.0.gem

Now push the gem to rubygems.org
$ gem push hello_gem-0.1.0.gem 
Enter your Gemcutter credentials. Don't have an account yet? Create one at http://gemcutter.org/sign_up
Email:   user@example.com
Password:   
Signed in. Your api key has been stored in ~/.gemrc
Pushing gem to Gemcutter...
Successfully registered gem: hello_gem (0.1.0)

Now gem is part of the Rubygems.

To add Gemcutter support to Jeweler
In the Rakefile, enter the line
Jeweler::GemcutterTasks.new
- This line has to added after the require 'jeweler'

Now check if we have the gemcutter functionality in Jeweler
$ rake -T
rake gemcutter:release   # Release gem to Gemcutter

Now execute the rake command to send the gem to rubygems.org
$ rake gemcutter:release
- This is exactly the same as 'gem push hello_gem-0.1.0.gem'

Now lets look at the current directory
$ tree
.
├── Gemfile
├── Gemfile.lock
├── hello_gem.gemspec
├── lib
│   └── hello_gem.rb
├── LICENSE.txt
├── pkg
│   └── hello_gem-0.1.0.gem
├── Rakefile
├── README.rdoc
├── spec
│   ├── hello_gem_spec.rb
│   └── spec_helper.rb
└── VERSION


3 directories, 11 files

So far the gem is empty so lets write something to it.
Let start writing to it, in the lib/hello_gem.rb
$ cat lib/hello_gem.rb
class HelloGem
  def self.hi
    puts "Hello World!"
  end
end

Now bump the version to a minor release
$ rake version:bump:minor
Current version: 0.1.0
Updated version: 0.2.0

Update the gem in ur local machine
$ rake install
  Successfully built RubyGem
  Name: hello_gem
  Version: 0.2.0
  File: hello_gem-0.2.0.gem
Executing "ruby -S gem install ./pkg/hello_gem-0.2.0.gem":
ruby -S gem install ./pkg/hello_gem-0.2.0.gem
Successfully installed hello_gem-0.2.0
1 gem installed
Installing ri documentation for hello_gem-0.2.0...
Installing RDoc documentation for hello_gem-0.2.0...

Check if the gem is updated.
$ irb
ruby-1.9.2-p290 :001 > require 'hello_gem'
 => true 
ruby-1.9.2-p290 :002 > HelloGem.hi
Hello World!
 => nil 

Modify the gem file to require another file.
- create a directory in the lib with the same name 'hello_gem'
$ mkdir lib/hello_gem

- create a file called translator.rb and write the following
$ cat lib/hello_gem/translator.rb
class Translator
  def initialize(language)
    @language = language
  end


  def hi
    case @language
      when 'spanish'
        "Hola Mundo!"
      when 'english'
        "Hello World!"
      else
        "ERROR !!!"
    end
  end
end


- Modify the gemfile to include this translator
$ cat lib/hello_gem.rb
require 'hello_gem/translator'

class HelloGem
  def self.hi(language = 'english')
    translator = Translator.new(language)
    translator.hi
  end
end

Now update the git repository
$ git add .
$ git commit -am "hello_gem/translator added"
$ rake version:bump:minor
$ rake install
$ irb
> require 'hello_gem'
 => true 
> HelloGem.hi
 => "Hello World!" 
> HelloGem.hi('english')
 => "Hello World!" 
> HelloGem.hi('spanish')
 => "Hola Mundo!" 
> HelloGem.hi('hindi')
 => "ERROR !!!" 

To make the executable
$ mkdir bin
$ touch bin/hello_gem
$ chmod a+x bin/hello_gem

Edit the bin/hello_gem
$ cat bin/hello_gem
#!/usr/bin/env ruby


require 'hello_gem'
puts HelloGem.hi(ARGV[0])

To make this executable, we have include the following line in the gemspec
$ cat hello_gem.gemspec
Gem::Specification.new do |s|
  :
  s.executables << 'hello_gem'
end

Update the git repository and reinstall the gem
On the command line
$ hello_gem english
Hello World!
$ hello_gem spanish
Hola Mundo!

Testing, In the spec folder, edit hello_gem_spec.rb
$ cat spec/hello_gem_spec.rb

require File.expand_path(File.dirname(__FILE__) + '/spec_helper')


describe "HelloGem" do
  it "should return Hello World" do
    HelloGem.hi.should == 'Hello World!'
  end
  it "should return Hello World" do
    HelloGem.hi('english').should == 'Hello World!'
  end
  it "should return Hola mundo" do
    HelloGem.hi('spanish').should == 'Hola Mundo!'
  end
  it "should return error" do
   HelloGem.hi('french').should == 'ERROR !!!'
  end


end

Execute the tests to make sure it passes
$ rspec spec/
....

Finished in 0.0005 seconds
4 examples, 0 failures

Documentation of work.
In the hello_gem.rb
$ cat lib/hello_gem.rb
# The main HelloGem class
class HelloGem
  # Say Hi to the world.
  #
  # Example:
  #   >> HelloGem.hi('spanish')
  #   => Hola Mundo!
  #
  # Arguments:
  #   language: (string)
  
  def self.hi(language = 'english')
  :


Resouces: 
http://guides.rubygems.org/make-your-own-gem/
http://asciicasts.com/episodes/183-gemcutter-jeweler

Monday, October 17, 2011

Denoising pyrosequencing reads

Tools to denoise pyrosequencing reads.


1. Denoiser
- Software for rapidly denoising pyrosequencing amplicaon reads by exploiting rank-abundance distributions.
- It is an alternative to PyroNoise software suite
- It is included in the new release of Qiime 1.3
Download

$ wget http://www.microbio.me/denoiser/Denoiser_0.91.tgz
$ tar zxvf Denoiser_0.91.tgz
$ cd Denoiser_0.91


Pre-requisites

Python: >= 2.5.1        http://www.python.org
PyCogent toolkit: >= 1.4        http://pycogent.sourceforge.net
ghc: >= 6.8 (recommended for install)  http://haskell.org/ghc


Install pre-requisites
$ sudo apt-get install ghc

Install Denoiser

$ cd FlowgramAlignment
$ make
ghc --make -O2 FlowgramAli_4frame
[1 of 3] Compiling ADPCombinators   ( ADPCombinators.lhs, ADPCombinators.o )
[2 of 3] Compiling FlowgramUtils    ( FlowgramUtils.lhs, FlowgramUtils.o )
[3 of 3] Compiling Main             ( FlowgramAli_4frame.lhs, FlowgramAli_4frame.o )
Linking FlowgramAli_4frame ...
$ make install
cp FlowgramAli_4frame ../bin/

Provide the path to Denoiser in ~/.bashrc file

PYTHONPATH=$PYTHONPATH/:$HOME/software/Denoiser_0.9/
export PYTHONPATH

Define variable in Denoiser/settings.py

PROJECT_HOME = home + "/path/to/Denoiser_0.91/"

Follow the mini-tutorial in README to denoise the sequences
To get fasta file, quality file and sff text file from sff file

$ sffinfo  454Reads.sff > 454Reads.sff.txt
$ sffinfo -s 454Reads.sff > 454Reads.fasta
$ sffinfo -q 454Reads.sff > 454Reads.qual

Quality Filtering and barcode assignment

$ denoiser/split_libraries.py -f 454Reads.fasta -q 454Reads.qual -m barcode_to_sample_mapping.txt -w 50 -r -l 150 -L 350
where,
-f fasta file
-q quality file
-m barcode mapping file
-w enable sliding window test for quality scores

-r remove unassigned reads (deprecated)
-l minimum sequence length
-L maximum sequence length


Prefix clustering

$ preprocess.py -i 454Reads.sff.txt -f seqs.fna -o example_pp -s -v -p CATGCTGCCTCCCGTAGGAGT
where, 
-i SFF text file
-f quality filtered sequence file
-o output directory
-s squeeze, run-length encoding for prefix-filtering
-v verbose
-p the primer sequence

Flowgram clustering and Denoising

denoiser.py -i 454Reads.sff.txt -p example_pp -v -o example_denoised
where,
-i SFF text file
-p Output directory of prefix clustering

-v verbose
-o output directory




2. Pre-cluster
- It is part of the mothur package
- It a pseudo-single linkage algorithm with the goal of removing sequences that are likely due to pyrosequencing errors.


3. SeqNoise

Wednesday, October 12, 2011

Python :: Installation :: Without root access

Operating System: Ubuntu 64-bit

Download Python from http://www.python.org/getit/

$ wget http://www.python.org/ftp/python/2.7.2/Python-2.7.2.tar.bz2
$ bunzip2 Python-2.7.2.tar.bz2
$ tar xvf Python-2.7.2.tar
$ ./configure --prefix=$HOME/bin/python
$ make
$ make install

Check if it works
$ $HOME/bin/python/bin/python

Load the path in your .bashrc file
$ echo "PATH=$PATH:$HOME/python/bin" >> ~/.bashrc
$ source ~/.bashrc

No we should be able to run python.

Tuesday, October 4, 2011

Qiime-1.3.0 :: Installation

Download Qiime-1.3.0 from
URL: http://sourceforge.net/projects/qiime/files/releases/Qiime-1.3.0.tar.gz/download

Installation on Ubuntu 64-bit machine

Extract the contents in the tar ball
$ tar zxvf Qiime-1.3.0.tar.gz
$ cd Qiime-1.3.0
$ vim README

Dependencies( check and Install)
1. Python >= 2.6
$ python --version
Python 2.7.1+

2. NumPy >= 1.3.0
$ tar zxvf numpy-1.6.1.tar.gz
$ cd numpy-1.6.1/
$ python setup.py install --user   # installs to your home directory

or
$ sudo apt-get install python-numpy python-numpy-doc

3. PyCogent >= 1.5.1.
Extract the contents
$ tar zxvf PyCogent-1.5.1.tgz
$ cd PyCogent-1.5.1/

With root access,
$ python setup.py build
$ sudo python setup.py install

Without root access,
$ python setup.py build_ext -if
- which compiles the extensions in place (the i option) forcibly (the f option, ie even if they’ve already been compiled).
- move the cogent directory to where you want it (or leave it in place)
- add this location to your python path using sys.path.insert(0, "/your/path/to/PyCogent") in each script, or by setting shell environment variables (e.g. $ export PYTHONPATH=/your/path/to/PyCogent:$PYTHONPATH)

4. Matplotlib
$ sudo apt-get install python-matplotlib 


Installation Qiime
$ python setup.py install --install-scripts=/home/username/qiime/bin/ --install-purelib=/home/username/qiime/lib/ --install-data=/home/username/qiime/lib/
- where user has to be replaced with username of the current user.
- As of now, it runs into a problem
:
running install_data
error: can't copy 'qiime/support_files/denoiser/bin/FlowgramAli_4frame': doesn't exist or not a regular file.

I looked up in Qiime Google groups page, as of this post, the developers has been informed on this error with setup.py and they have mentioned on rectifying it. This error may not show when u download. If it does, then a small trick completes the installation. Just run the below command and rerun the setup.py command
$ touch qiime/support_files/denoiser/bin/FlowgramAli_4frame

NOTE: 
- If you DO NOT intend on using denoiser, it works good
- If you Do intend on using denoiser, it will create an error called
cogent.app.util.ApplicationError: Calling /home/username/qiime/lib/qiime/support_files/denoiser/bin/FlowgramAli_4frame failed. Check permissions and that it is in fact an executable.
- I am not sure yet how to solve this.

The build will succeed with the following message
Build finished. The HTML pages are in _build/html.
Local documentation built with Sphinx. Open to following path with a web browser:
/path/to/Qiime-1.3.0/doc/_build/html/index.html

If you have installed Qiime using above steps then you have to provide path in .bashrc file
$ echo "export PATH=/home/username/qiime/bin/:$PATH" >> ~/.bashrc
$ echo "export PYTHONPATH=/home/username/qiime/lib/:$PYTHONPATH" >> ~/.bashrc
$ source ~/.bashrc
- dont forget to replace the username with your username

Now move the qiime config file to your home directory
$ cp qiime/support_files/qiime_config ~/.qiime_config

Since we created the binary files in another location, we have to provide the path to it in the configuration file. Look for the line that begins with qiime_scripts_dir
$ vim ~/.qiime_config
qiime_scripts_dir /home/username/qiime/bin
- Note, the white space between the two values is a tab, Dont use space
- Also dont forget to replace the username with your username.

Testing
Move to the tests folder and execute the tests script
$ cd tests
$ python all_tests.py





Friday, September 9, 2011

HTML5 :: div :: rounded corners :: webkit

CSS with webkit
.round {
  -moz-border-radius:    10px;
  -webkit-border-radius: 10px;
}

CSS without webkit
.round {
  // All corners are round
  border-radius: 10px;
  // diagonally opposite corners are rounded;
  border-radius: 10px 3px;
  // custom round
  border-radius: 20px 3px 8px 14px;
}

HTML5 :: Work in IE8


HTML5 tags dont work on IE, to make it work include the lines below in the <head>

<!--[if lt IE 9]>
<script src="http://html5shim.googlecode.com/svn/trunk/html5.js"></script>
<![endif]-->;